subject
Biology, 30.11.2020 17:40 MartinTDL

what necessary interactions are required for activation of helper T cells and what necessary interactions are required for activation of cytotoxic T cells

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 07:30
Which statements best describe the differences or similarities between a comparative investigation and an experimental investigation? check all that apply. experimental investigations are best for showing cause-and-effect relationships, while comparative investigations do not necessarily show this type of relationship. comparative investigations are often impractical and unrealistic, while experimental investigations are the most practical and realistic kinds of investigations. comparative investigations allow for the use of a wide range of variables but do not have a control group, while experimental investigations involve variables that can be controlled. both experimental investigations and comparative investigations are designed to answer scientific questions. both experimental investigations and comparative investigations focus on making observations rather than collecting new data.
Answers: 1
question
Biology, 22.06.2019 09:00
What is the significance of the protein-lined pits? a. protein attracts other proteins needed for atp synthesis within the cell. b. protein-lined pits are able to transport one molecule at a time down the concentration gradient within the cell. c. the polarity of proteins allows other polar molecules to attach and be transported in the cell by transport channels. d. receptors within the pits allow ligands to fuse and be transported into the cell by endocytosis.
Answers: 2
question
Biology, 22.06.2019 09:30
Describe your dna model. which part do the straws represent? the pushpins? the paper clips and the black dots you made with the marker?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
what necessary interactions are required for activation of helper T cells and what necessary interac...
Questions
question
History, 20.10.2020 23:01
question
Mathematics, 20.10.2020 23:01
question
Health, 20.10.2020 23:01
question
Mathematics, 20.10.2020 23:01
Questions on the website: 13722363