Identify which mutation occurred (insertion, deletion, substitution, or silent substitution) and highlight where the mutation occurred.
Original DNA: TACGGGATGTTCCCA
Mutation #1: TACGGGACCCA
Mutation #2: TACGGGAGTTCCCAT
Mutation #3: TACGGGATGTCTCCC
Mutation #4: TACGGTATGTTCCCA
Answers: 1
Biology, 21.06.2019 13:40
Which would prevent a plant from growing? oa. lack of sunlightob. no supply of lithiumoc. too much waterd. too many monosaccharides
Answers: 1
Biology, 21.06.2019 19:00
The model illustrates a process by which a substance is taken up by a cell
Answers: 2
Biology, 22.06.2019 06:30
Which of the following is a common response to cell signaling?
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Identify which mutation occurred (insertion, deletion, substitution, or silent substitution) and hig...
Mathematics, 17.09.2019 19:10
Mathematics, 17.09.2019 19:10
Mathematics, 17.09.2019 19:10
Health, 17.09.2019 19:10
Biology, 17.09.2019 19:10
Computers and Technology, 17.09.2019 19:20
Chemistry, 17.09.2019 19:20
Mathematics, 17.09.2019 19:20
Mathematics, 17.09.2019 19:20
History, 17.09.2019 19:20