(The genetics of sickle cell anemia)
Explain how it would be possible to have a change i...
Biology, 23.11.2020 06:30 shantejahtierr3754
(The genetics of sickle cell anemia)
Explain how it would be possible to have a change in a single base of DNA, but have the protein NOT change and be functional.
Answers: 1
Biology, 22.06.2019 02:30
Part e - sequence of metabolic processes each of the different cellular metabolic pathways occurs in a specific order. consider aerobic cellular metabolism from the beginning to end. what is the sequential order of the metabolic processes that starts with glucose and results in the production of carbon dioxide, water, and atp? put the following in the correct sequential order. rank from earliest to latest. to rank items as equivalent, overlap them. view available hint(s) acetyl coaglycolysiscitric acid cycle pyruvate finishstartstart background image electron transport chain background image finish background image submit cellular metabolism is often expressed as an equation. this equation puts into perspective, on a general scale, the substances needed to start cellular metabolism and the products that come out of it. the equation represents the overall product yield after every step of cellular metabolism is complete (i.e., glycolysis through the electron transport system). in this part of the tutorial you task will be to put together the equation that represents cellular metabolism. you will also learn the products that result from each metabolic pathway and the role that some these products play in the production of atp.
Answers: 2
Biology, 22.06.2019 10:30
What is the best conclusion based on this data? the hypothesis was not supported because the data indicated that fertilizing plants does not improve plant growth. the hypothesis was supported; to get the best growth, use 5 milliliters of fertilizer per plant. the hypothesis was not supported; the data indicated that too much fertilizer can inhibit plant growth. the hypothesis was supported; to get the best growth, use 15 milliliters of fertilizer per plant.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 25.11.2021 20:20
History, 25.11.2021 20:20
Mathematics, 25.11.2021 20:20
Mathematics, 25.11.2021 20:20
English, 25.11.2021 20:20
Mathematics, 25.11.2021 20:20
Mathematics, 25.11.2021 20:20
English, 25.11.2021 20:20
Social Studies, 25.11.2021 20:20
Mathematics, 25.11.2021 20:20
Mathematics, 25.11.2021 20:20