![subject](/tpl/images/cats/biologiya.png)
Biology, 19.11.2020 22:00 jojojojo5730
Pay attention to the question that is being asked. You will be asked to go from DNA to DNA,
DNA to RNA, or RNA to RNA.
1.
Go from DNA to DNA for the following strands
a. AAATCCGTCGTTACACACACAACA
b. TTATATATATAGCGCGCGCGCGCGCGC
c. CGAT
d. GCGCGCGCGCGCGCGCGCGCGCGCGCGCG
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:00
The pharynx is the structure in the body that serves as a pathway of both air and food. how does the body make sure that food does not get into the lungs? the salivary glands secrete enzymes that pull food out of the air pathway. the small intestine pushes the air out of the digestive system. the pancreas breaks down food in the air pathway. the epiglottis closes the air pathway so that food will not enter it.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:30
Plz ! for many generations farmers in north america have been choosing to cross corn plants with large ears of corn each year this results in the new generation of plants also growing large ears of corn. what is the technique called? a. selective breeding. b. natural selection. c. mitosis. d. asexual budding.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00
Answers to mastering biology drag the labels to their appropriate locations to complete the punnett squares for morgan's reciprocal cross. drag blue labels onto the blue targets to indicate the genotypes of the parents and offspring. drag pink labels onto the pink targets to indicate the genetic makeup of the gametes (sperm and egg). labels can be used once, more than once, or not at all. hints
Answers: 3
You know the right answer?
Pay attention to the question that is being asked. You will be asked to go from DNA to DNA,
DNA to...
Questions
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 15.10.2019 20:10
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/es.png)