Ocean water has chemicals that do not negatively affect metal ships.
True
Fa...
![subject](/tpl/images/cats/biologiya.png)
Biology, 19.11.2020 18:20 nathaliapachon1254
Ocean water has chemicals that do not negatively affect metal ships.
True
False
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:00
Will mark brainliest. (20 points) many have pigments structures known as eyespots that detect direction of light. a. b. archaebacteria c. protists d. none of the above
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:00
The empty trna moves off and picks up another matching amino acid from the cytoplasm in the cell. the anticodon of the trna, with its attached amino acid, pairs to the codon of the mrna, which is attached to a ribosome. this sequence is repeated until the ribosome reaches a stop codon on the mrna, which signals the end of protein synthesis. the ribosome forms a peptide bond between the amino acids, and an amino acid chain begins to form. when a second trna with its specific amino acid pairs to the next codon in sequence, the attached amino acid breaks from the first trna and is bonded to the amino acid of the second trna.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00
Which short-term environmental changes would a very small asteroid or comet impact on earth most likely cause? check all that apply. flooding extinction craters on surface changes in weather patterns death of organisms and populations
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 12.10.2020 15:01
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
English, 12.10.2020 15:01
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 12.10.2020 15:01
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.10.2020 15:01
![question](/tpl/images/cats/en.png)
English, 12.10.2020 15:01
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 12.10.2020 15:01
![question](/tpl/images/cats/en.png)
English, 12.10.2020 15:01
![question](/tpl/images/cats/mat.png)
Mathematics, 12.10.2020 15:01
![question](/tpl/images/cats/mat.png)
Mathematics, 12.10.2020 15:01
![question](/tpl/images/cats/mat.png)
Mathematics, 12.10.2020 15:01
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.10.2020 16:01