GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTA GAAG How many proteins were

The terrestrial planets are characterized by having a a.) silicate core b.) iron-rich silicate core c.) iron-rich metallic core d.) none of these

What best describes the structure of the declaration of independence?

8) animals respond in various ways to stimuli detected through their senses. some of these responses are stimulated by the presence of danger. which of these animal responses is the best example of a response to an immediate threat? a) a rooster crows every morning at the first sign of light. b) as something approaches an octopus, it shoots a cloud of ink. c) from late fall until spring, bears hibernate to preserve energy. d) a dog is getting hot in the sunlight, so he moves to a shaded area.