Biology, 22.10.2020 21:01 mckennacwilliams

The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and the A on both strands. How many restriction sites are there in the following sequence? ATTOTTOMTTCOTATTGAATTCCO TACACTTAGCATAATTAAGGG
1)none
2)one
3)not enough information
4)three
5)two.

The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and

Answers: 3

Show answers

Another question on Biology

Biology, 22.06.2019 00:50

Which of the following is a macronutrient? carbohydrates lipids amino acids all of the above

Answers: 2

Answer

Biology, 22.06.2019 04:10

Anne, an intern in a microbiology lab, was observing the characteristics of various specimens of protists. match each specimen to the category of protist to which it belongs.

Answers: 1

Answer

Biology, 22.06.2019 04:30

This part insulates the reaction chamber from the transfer of heat to or from the surrounding environment

Answers: 1

Answer

Biology, 22.06.2019 10:00

Which statement best compares aerobic and anaerobic respiration

Answers: 1

Answer

You know the right answer?

The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and...

Questions

Physics, 11.07.2019 10:30

Awet towel is hanging on a clothesline in the sun. the towel dries by the process of and why...

Mathematics, 11.07.2019 10:30

Geometry ! ! a sequence of transformations that maps △abc to △a′b′c′ a: (-4,3) b: (-1,3) c: (-2,1) a': (-1,-4) b': (-1,-1) c': (1,-2) pick...

Mathematics, 11.07.2019 10:30

Roesha spent $8.50 every hour for 2.5. write and simplify and expression and to determine the total amount of money she spent...

English, 11.07.2019 10:30

What elements are of particular concern when developing a character in historical fiction?...

Mathematics, 11.07.2019 10:30

If you need 2 1/3 cups of flour, how many batches of cookies can you make with 10 cups of flour?...

English, 11.07.2019 10:30

11. persuasive words used in persuasive writing include support, fact, and accurate should, must, and ought persuasion, convince, and instruct ca...

Mathematics, 11.07.2019 10:30

Before cam broke his right arm he was able to text 9 words per minute on his phone after he broke his arm he had to use his left arm for a while and c...

Biology, 11.07.2019 10:30

Fossil fuels contain energy that originally came from a. tidal forces. b. earth’s core. c. the sun. d. dinosaurs....

Arts, 11.07.2019 10:30

Which of the following passages best experiences mark twain's purpose in " a cub pilot "...

History, 11.07.2019 10:30

In the 1800s, mass production was made by...

Biology, 11.07.2019 10:30

The source of energy for most autotrophs is a. water. b. the sun. c. heterotrophs. d. other autotrophs....

Chemistry, 11.07.2019 10:30

We use the classification system when grouping organisms, which are veey diverse. which is the subgroup with the least amount od diversity?...

English, 11.07.2019 10:30

Because the city was on a hill surrounded by canyons and caverns, its location was very safe. a. simple c. compound-complex b. compound d. complex...

English, 11.07.2019 10:30

Which one of the following words contains a derivation suffix that tells you the word is a noun...

Mathematics, 11.07.2019 10:30

Expenses that can vary from month to month....

English, 11.07.2019 10:30

Which of the following might you use a thesaurus to find...

Chemistry, 11.07.2019 10:30

What reacts more easily with oxygen: iron, paint, or chromium?...

English, 11.07.2019 10:30

Eighteen-year olds can vote in israel, but they must also serve in the armed forces. a. simple c. compound-complex b. compound d. complex...

English, 11.07.2019 10:30

The president is elected to a five-year term, yet most of his or her duties are ceremonial. a. simple c. compound-complex b. compound d. complex...

Physics, 11.07.2019 10:30

What factors should you consider before purchasing the burger...

More questions: Biology Another questions

The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and the A on both strands. How many restriction sites are there in the following sequence? ATTOTTOMTTCOTATTGAATTCCO TACACTTAGCATAATTAAGGG 1)none 2)one 3)not enough information 4)three 5)two.

Answers

Another question on Biology

The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and the A on both strands. How many restriction sites are there in the following sequence? ATTOTTOMTTCOTATTGAATTCCO TACACTTAGCATAATTAAGGG
1)none
2)one
3)not enough information
4)three
5)two.