*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a part...
Biology, 19.10.2020 08:01 dflorez3064
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Highlighted letters are: ATACTACC
Answers: 2
Biology, 21.06.2019 22:00
Which of the following does not describe a physical property of iron? a iron is silvery-white or gray in color. b iron has a boiling point of about 3,000°c. c iron is a magnetic element . d iron and sulfur react to form iron sulfide.
Answers: 1
Biology, 22.06.2019 13:00
How would you expect the mrna codons that code for the amino acids that make up hemoglobin to compare between humans
Answers: 1
Biology, 22.06.2019 20:30
If the selected review was submitted in word format, what are the posterior probabilities of it being short, medium, or long? (round your answers to three decimal places.)
Answers: 1
Biology, 23.06.2019 04:00
Where is the female part of a plant located? a.in the pollen b.in the roots c.in the stem d.inside the flower
Answers: 2
Mathematics, 26.11.2019 06:31
Mathematics, 26.11.2019 06:31
Physics, 26.11.2019 06:31
History, 26.11.2019 06:31
Mathematics, 26.11.2019 06:31
Biology, 26.11.2019 06:31
Mathematics, 26.11.2019 06:31
English, 26.11.2019 06:31
Arts, 26.11.2019 06:31