subject
Biology, 19.10.2020 08:01 dflorez3064

*MAY* give brainliest! Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Highlighted letters are: ATACTACC

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 03:30
Which type of respiration takes place when there is no oxygen present
Answers: 2
question
Biology, 22.06.2019 05:20
The mammal pictured below is a silvery mole rat. which statement is an inference based on the picture? the animal is ugly. the animal has hairless feet with sharp claws. the animal has prominent upper and lower incisor teeth. the animal likely has poor vision since its eyes are so small.
Answers: 2
question
Biology, 22.06.2019 09:00
Which statement best describes the role of religion and culture in ancient medicine?
Answers: 1
question
Biology, 22.06.2019 09:30
Astore manager timed janette to see how long it would take her to fold and put away a sweater, a shirt, a pair of pants, and a scarf. it took her 26.1 seconds for the shirt, 24.3 seconds for the sweater, 32.8 seconds for the pants, and 18.2 seconds for the scarf. what was the average time it took janette to fold and put away all four items? during a catered lunch, an average of 4 cups of tea are poured per minute. the lunch will last 2 hours. how many gallons of tea should the caterer bring if there are 16 cups in one gallon?
Answers: 1
You know the right answer?
*MAY* give brainliest! Please give answer and explain:

This sequence encodes for a part...
Questions
question
Computers and Technology, 19.10.2019 00:40
Questions on the website: 13722363