*MAY* give brainliest! Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

What protects the lining of the stomach from acidic gastric juices?

Leila has dimples because she received a gene copy from her father that coded for dimples. this means that dimples are an example of a trait that is

Researchers determine that the biodiversity in a woodland region is declining. they identify two major threats to the region's biodiversity, a method to address each threat, and the expected outcome of each method. this information is shown in the table. threat method number of species that benefit number of years to see benefit habitat fragmentation reforestation 450 8 introduced prey species biological augmentation 150 2 which statement is an accurate explanation of the information in the table? a. biological augmentation would benefit only a few species because it is typically not very effective. b. biological augmentation would take less time to be effective because it targets the majority of prey species. c. reforestation would take the longest time to be effective because trees take several years to grow. d. reforestation would not benefit many species because most forest species live on the ground.