subject
Biology, 10.09.2020 04:01 crodriguez87

What is the role of the gametophyte in fernsg?

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 22:00
Type the correct answer in the box. use numerals instead of words. fiona has a lovely flower bed in her yard. she wants to add a fence along one side of the flower bed. the fence material is sold in meters. fiona knows that her flower bed is 200 centimeters in length. how much fencing material does fiona need in meters? fiona needs meters of fencing material for her flower bed.
Answers: 3
question
Biology, 22.06.2019 03:00
Which sentence best describes the relationship between chlorophyll and the chloroplast? a.)chlorophyll is a chemical found in a chloroplast. b.) chloroplast is a chemical found in a chlorophyll. c.) both chlorophyll and chloroplasts are found in animals. d.) both chlorophyll and chloroplasts make carbon dioxide.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
The embryos of a bird, a reptile, and a mammal are similar in appearance. how does comparing the physical appearance of embryos of different species support the theory of evolution? a. it shows that these organisms share a common ancestor. b. it provides evidence that these organisms eat the same foods.c. it shows that these organisms share the same habitat.d. it provides evidence that these organisms suffered a genetic mutation.
Answers: 1
You know the right answer?
What is the role of the gametophyte in fernsg?...
Questions
question
Mathematics, 12.01.2021 21:30
question
History, 12.01.2021 21:30
question
Mathematics, 12.01.2021 21:30
Questions on the website: 13722361