Which succession occurs in a community that was never colonized before? A. secondary B. artificial C. temporary D. primary

Draw the structure of dna nucleotide with adenine as nitrogenous base

In the united states there are strict fishing seasons and limits, but not all countries enforce similar laws. in bangladesh there are few if any fishing restrictions. what might be the reason for less restrictions in smaller countries like bangladesh? a) the united states is the only country worried about overfishing. b) the united states wants to limit the supply of fish to increase the price. c) bangladesh and smaller countries have an unlimited supply of fish in their coastal waters. d) small countries, such as bangladesh, are practicing subsistence fishing, taking only the fish needed to survive.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?