Biology, 01.07.2020 15:01 stefancvorovic1

An individual has a mutation in the gene that codes for hemoglobin. This results in sickle cell disease. Choose the correct explanation for how this mutation affects the individual's traits. a. The error in the DNA sequence results in an error in the mRNA molecule during transcription, the error in the mRNA molecule results in an incorrect amino acid in the hemoglobin protein which makes it non-functional. The resulting trait is sickle cell disease.
b. The error in the mRNA sequence results in an error in the DNA molecule during transcription, the error in the DNA molecule results in an incorrect nucleic acid in the hemoglobin protein which makes it non-functional. The resulting trait is sickle cell disease.
c. The error in the DNA sequence results in an error in the mRNA molecule during transcription, the error in the mRNA molecule results in an incorrect nucleic acid in the hemoglobin protein which makes it non-functional. The resulting trait is sickle cell disease.
d. The error in the mRNA sequence results in an error in the DNA molecule during transcription, the error in the DNA molecule results in an incorrect amino acid in the hemoglobin protein which makes it non-functional. The resulting trait is sickle cell disease.

Answers: 1

Show answers

Another question on Biology

Biology, 22.06.2019 11:00

Need the diagram below, which is not drawn to scale, shows the position of the earth, moon, and sun. what type of eclipse occurs when the earth, moon, and sun are lined up in the order shown? a. planetary eclipse b. solar eclipse c. martian eclipse d. lunar eclipse

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

Biology, 22.06.2019 18:30

In which order does sexual reproduction take place in plants? a. pollination, germination, fertilization b. germination, fertilization, pollination c. pollination, fertilization, germination d. fertilization , pollination, germination

Answers: 1

Answer

Biology, 22.06.2019 22:00

Organ systems are composed of organs, organs are composed of tissues, and tissues are composed of cells. this pattern is organized into levels. organization based on levels can be found in what

Answers: 3

Answer

You know the right answer?

An individual has a mutation in the gene that codes for hemoglobin. This results in sickle cell dise...

Questions