Biology, 10.06.2020 09:57 matthewbranch7780
1. The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of uracil in RNA.
True or False?
2. The correct steps of the scientific methods are: experiment, conclusion, exploration, application
True or False
Answers: 3
Biology, 21.06.2019 15:30
Use the drop-down menu to complete the statement. an electron in the first energy level of the electron cloud has an electron in the third energy level.a. a lower energy thanb. a higher energy thanc. the same energy as
Answers: 1
Biology, 21.06.2019 20:40
Question 1(multiple choice worth 3 points) (06.04 lc) which of the following is true about repetition in an experiment? it involves setting up of a hypothesis. it involves multiple trials. it involves data analysis. it involves peer review. question 2(multiple choice worth 3 points) (06.03 mc) the trait for flower color in a plant has red and white alleles. the red color is the dominant trait. what is the phenotypic ratio for a cross between plants with red (rr) flowers and white (rr) flowers? 4 red : 0 white 3 red : 1 white 2 red : 2 white 0 red : 4 white question 3(multiple choice worth 3 points) (06.01 mc) the following table describes some biotechnological processes. biotechnological processes process description 1 producing offspring that have identical dna as one parent 2 crossing a high-yielding fruit variety with a high-vitamin variety which biotechnological processes are described in the table? both processes describe cloning. both processes describe genetic engineering. process 1 describes cloning and process 2 describes artificial selection. process 1 describes artificial selection and process 2 describes cloning. question 4(multiple choice worth 3 points) (05.04 mc) which of the following adaptations best polar bears walk on snow? furry feet slippery feet small feet white-colored feet question 5(multiple choice worth 3 points) (06.01 hc) a team of scientists altered the dna of e. coli bacteria. the bacteria thus developed had the ability to generate insulin exactly identical to the human insulin molecule. what could be the likely impact of this biotechnology on the individual and the society? the medical costs for insulin-dependent patients would rise. large-scale insulin could be produced in relatively lesser time. the price of insulin available from sources other than bacteria may fall. the patients who take insulin may become infected with e. coli bacteria. question 6(multiple choice worth 3 points) (06.03 lc) which of the following is used to represent a recessive trait in a punnett square? an uppercase letter a lowercase letter a shaded square a shaded circle question 7(multiple choice worth 3 points) (06.03 mc) cystic fibrosis is a recessive gene disorder. the pedigree chart for a family known to have cystic fibrosis is shown below. a half shaded circle is shown connected by a straight line to an unshaded square. underneath the half shaded circle are the letters aa which represent the genotype for the first parent. underneath the second parent the letters, aa, appear representing the genotype for the other parent. below this is another row of circles and squares. this 2nd row represents the offspring. starting from the left a half shaded circle is shown connected to an unshaded square, followed by an unshaded square, and then an unshaded circle. each of the circles and squares, offspring, are connected by a horizontal straight line that connects to the parent group above. the genotype is written under each of the offspring in order from left to right; aa, aa, aa, aa. what percentage of the offspring have observable disease? 0% 25% 50% 75% question 8(multiple choice worth 3 points) (06.03 lc) which of the following is an example of a homozygous recessive allele? rr rr rr rw question 9(multiple choice worth 3 points) (06.03 mc) the pod color in pea plant can be yellow or green. a pea plant with yellow pods (yy) is crossbred with another pea plant with green pods (yy). what is the probability of offspring with green pods? 0% 25% 50% 75% question 10(multiple choice worth 3 points) (06.02 mc) a pea plant has white flowers. it has a genotype pp. which of the following about the gene of flower color in the pea plant is true? the allele for white flowers is dominant in the pea plant. the allele for white flowers is recessive in the pea plant. the plant received both dominant alleles from both the parents. the plant received a dominant and a recessive allele from each parent. the characteristics of certain cell divisions are described in the following table. cell division characteristics characteristic description 1 forms diploid cells 2 creates sex cells, or gametes which type(s) of cell division do the two characteristics represent? both characteristics represent meiosis. both characteristics represent mitosis. characteristic 1 represents meiosis and characteristic 2 represents mitosis. characteristic 1 represents mitosis and characteristic 2 represents meiosis.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30
Are the layers of rock above and below the coal older or younger?
Answers: 1
1. The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to th...
History, 15.04.2021 07:20
History, 15.04.2021 07:20
English, 15.04.2021 07:20
Mathematics, 15.04.2021 07:20
Chemistry, 15.04.2021 07:20
Mathematics, 15.04.2021 07:20
Mathematics, 15.04.2021 07:20
English, 15.04.2021 07:20
History, 15.04.2021 07:20
Advanced Placement (AP), 15.04.2021 07:20
Mathematics, 15.04.2021 07:20
Mathematics, 15.04.2021 07:20
Spanish, 15.04.2021 07:20