The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is read from left to right.

AUUUAACUGUUCUGUCUAGAG

1. Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

2. Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

What causes the phospholipids to organize themselves the way they do

Approximately 90% of all cases of polycystic kidney disease are inherited in an autosomal dominant fashion. the disease is typically related to mutations to genes (pkd1 and pkd2). pkd genes can be found on chromosome 16. the disease occurs in approximately 1: 800 to 1: 1000 people. here is a hypothetical example. the dominant allele d will cause the development of pkd. the recessive allele is known as d. what genotypes would correspond to suffering from pkd? dd, dd what genotypes would correspond to being normal (not suffering from pkd)? dd consider that 1: 1,000 people have pkd in your population of 325million. consider that pkd is inherited in an autosomal dominant fashion. show you math for all of the following questions: what is the genotypic frequency for dd? what is the genotypic frequency for dd? what is the genotypic frequency for dd? what is p? what is q? how many people in your population would have pkd?

Explain why the plants cortex would serve as the best food source for animals