Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

Anybody who knows ap biology, can you friend or message me

After reading the paragraph below, answer the questions that follow. researchers have created a robot that has a very thin leg that is moved by cardiac (heart) cells contracting in unison. the robot, made of a polymer similar to that used in making contact lenses, is bathed in heart cells with supporting cells, which then attach to the robot and provide movement as they contract. all of the cardiac cells working together can cause the robot leg to move in a way that individual cells could not. this is an example of a. emergent properties of cells. b. energy flow through an ecosystem. c. adaptation. d. internal environment regulation.

Identify characteristics of energy from the sun. check all that apply. almost all of the energy on earth comes from the sun. energy from the sun is known as mechanical energy. the energy in fossil fuels originally came from the sun. plants convert the energy of sunlight into chemical energy.