subject
Biology, 21.04.2020 20:09 lukeramjitsingh

The appearance of a fertile, polyploid individual within a population of diploid organisms is a possible source of a new species. If this individual is capable of reproducing to form a new population, scientists would consider this to be an example of. A. allopatric speciationB. sympatric speciationC. polygenic inheritanceD. genetic driftE. Hardy-Weinberg equilibrium

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 07:30
The equation shows cellular respiration. during cellular respiration, glucose combines with oxygen to form carbon dioxide, water, and atp. what happens to the energy in the bonds in glucose? the energy is transferred to oxygen. the energy is transferred to carbon dioxide. the energy is transferred to water. the energy is transferred to atp.
Answers: 2
question
Biology, 22.06.2019 08:10
What’s the student’s scientific question
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:00
What could happen if two base pairs on a strand of dna or switched
Answers: 3
You know the right answer?
The appearance of a fertile, polyploid individual within a population of diploid organisms is a poss...
Questions
question
Mathematics, 04.02.2020 16:43
question
Mathematics, 04.02.2020 16:43
question
Mathematics, 04.02.2020 16:43
question
Mathematics, 04.02.2020 16:43
Questions on the website: 13722363