![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 18:00
Which of the following is not a product of the second stage of glycosis
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:00
2points what is the term for a female reproductive cell? a. egg b. chromatid c. allele d. fertilization
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:00
Which of the following is true of microbes? a. ninety-nine percent of all microbes are pathogenic.b. gene expression in bacteria is very similar to gene expression in humans, which facilitates the use of bacteria in recombinant biotechnology and gene therapy.c. all bacterial enzymes are harmful to humans and the environment.d. microbes create pollutants and toxins that harm the environment.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
When does meiosis occur?...
Questions
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.04.2020 02:16
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.04.2020 02:16
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/health.png)
Health, 27.04.2020 02:16
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/ekonomika.png)
Business, 27.04.2020 02:16
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/es.png)
Spanish, 27.04.2020 02:16