![subject](/tpl/images/cats/biologiya.png)
Biology, 17.04.2020 05:28 golderhadashaowtatz
1. You homogenize a cell and isolate it from a vesicle derivative from the endoplasmic reticulum. When their biochemistry was analyzed, they were found to have the ability to synthesize testosterone. From what type of ER are they derived and name the human body cell?
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:00
Plsss > .< compare and contrast the characteristics of flatworms rounds worms and earthworms
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:10
Recombinant dna is the merging of dna from unrelated organisms to create new genetic varieties is assembled in the lab from mononucleotides was part of the green revolution of the 1960s is pollination of one plant by another of the same species is cross-pollination of one plant by a different species
Answers: 1
You know the right answer?
1. You homogenize a cell and isolate it from a vesicle derivative from the endoplasmic reticulum. Wh...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 04.02.2021 19:50
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 04.02.2021 19:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 04.02.2021 19:50
![question](/tpl/images/cats/mat.png)
Mathematics, 04.02.2021 19:50
![question](/tpl/images/cats/himiya.png)
Chemistry, 04.02.2021 19:50
![question](/tpl/images/cats/mat.png)
Mathematics, 04.02.2021 19:50
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 04.02.2021 19:50
![question](/tpl/images/cats/mat.png)
Mathematics, 04.02.2021 19:50
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/istoriya.png)
History, 04.02.2021 19:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)