subject
Biology, 16.04.2020 23:14 cpcoolestkid4

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment? (Recall that the stop codons are 5' TAA, 5' TAG, and 5' TGA.)

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 06:20
You see a white marker with an orange circle and black lettering. what does this marker tell you
Answers: 1
question
Biology, 22.06.2019 07:30
9. the history of life on earth is recorded in
Answers: 1
question
Biology, 22.06.2019 09:30
What is the difference between a scientific hypotheses and a scientific theory?
Answers: 1
question
Biology, 22.06.2019 16:00
Autonomous underwater explorers will be used to gather large-scale ocean information select the best answer from the choices provided ot
Answers: 1
You know the right answer?
You perform Sanger sequencing on a small fragment of the human genome and obtain the following small...
Questions
question
Social Studies, 25.09.2020 01:01
question
Mathematics, 25.09.2020 01:01
question
Biology, 25.09.2020 01:01
Questions on the website: 13722363