The middle of an mRNA molecule contains the nucleotide
![subject](/tpl/images/cats/biologiya.png)
Biology, 15.04.2020 02:44 jamalchris9353
PLEASE HELP (WORTH 50 POINTS)
The middle of an mRNA molecule contains the nucleotide
sequence shown here. Much more of the mRNA is translated.
Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
Construct an Explanation Based only on the information provided, why could the mRNA
section be translated into three different sets of amino acids, instead of just one set?
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:00
Organ systems are composed of organs, organs are composed of tissues, and tissues are composed of cells. this pattern is organized into levels. organization based on levels can be found in what
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:40
Which of the following is true? a. under the current unemployment insurance system, benefits replace about 90 percent of the typical worker's prior pretax earnings. b. high benefit payments to unemployed workers will tend to increase the rate of unemployment. c. if a system of personal savings accounts replaced the current unemployment benefit system, the unemployment rate would fall to zero. d. the rate of unemployment in the large european economies has been persistently lower than that of the united states due to their more generous unemployment benefits.
Answers: 3
You know the right answer?
PLEASE HELP (WORTH 50 POINTS)
The middle of an mRNA molecule contains the nucleotide
The middle of an mRNA molecule contains the nucleotide
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mkx.png)
Arts, 10.03.2020 11:00
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 10.03.2020 11:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 10.03.2020 11:00
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 10.03.2020 11:00
![question](/tpl/images/cats/mat.png)
Mathematics, 10.03.2020 11:00
![question](/tpl/images/cats/mat.png)
Mathematics, 10.03.2020 11:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 10.03.2020 11:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/ekonomika.png)