Identify a hypothetical sequence of bases that might be found in the first 20 nucleotides of a promoter of a bacterial gene (in the nontemplate strand). The start site for transcription will be underlined, and a potential consensus sequence, if one exists, will be in italics. a. 5′–GGACTATATGATGCGGCCCAT–3′b. 5′–GGACTATATGATGCGGCCCAT–3′c. 5′–GGACTATATGATGCGGCCCAT–3′d. 5′–GGACTATATGATGCGGCCCAT–3′

Even though the ostrich is a flightless bird, ostriches still possess wings that stretch approximately two meters across when fully extended. scientists speculate that when dinosaurs became extinct, some of the birds that lived during that time became land dwellers since they were able to consume the food that the dinosaurs once ate. over time, these species grew larger and heavier. eventually, the ostrich species became too big to fly. the wings found on ostriches are known as a. analogous structures. b. homologous structures. c. vestigial structures. d. symmetrical structures.