The phosphodiester bonds that lie exactly in the middle of an 8-bp long segment of double-stranded DNA are broken to create two 4-bp long molecules. Phosphodiester bonds between the resulting two double- stranded molecules are then reformed, but withA. 5'-TTAACCGG-3' (on this strand the phosphodiester bond broken is between the A and the C)
B. 5'-AGCTTCGA-3' (on this strand the phosphodiester bond broken is between the T and the adjecent T).
C. 5'-TTCCAAGG-3' (on this strand the phosphodiester bond broken is between the C and the A)
D. 5'-AGCTAGCT-3' (on this strand the phosphodiester bond broken is between the T and the A)

What happens when water’s salinity increases? mass decreases. freezing point decreases. buoyancy of objects decreases. the amount of dissolved minerals decreases.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Select the correct answer from each drop-down menu. the lac operon in e.coli regulates genes that code for enzymes required for breakdown of lactose. the lac operon is operon that is activated in the presence of .