Does the same codon always control skin color eye color and the presence of spots
Why do you think this is the case?

What organ is the first to receive nutrients that have been absorbed from the digestive tract?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Astudent completed a lab report. which correctly describes the difference between the "question" and "hypothesis' sections of her report? "question states what she is asking, and "hypothesis" states the result of her experiment "question" states what she is asking, and "hypothesis" states what she thinks the answer to that question is in 'if. then because" format. "question" describes what she is trying to find out, and "hypothesis" states the procedures and methods of data collection. "question" describes what she is trying to find out, and "hypothesis" states any additional information or prior knowledge about the question