subject
Biology, 06.04.2020 18:11 khehnai

Arthropod body segments are sometimes distinct, sometimes indistinct and sometimes fused as groups to form body regions. Which groups of arthropods appear the most distinctly segmented?

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 21:20
How is mitosis different in plants and animals? a. in animals, the cell membrane pinches together. b. in plants,the dna is one circular chromosomes. c. in plants, there are no sister chromatids. d. in animals, a new cell wall forms.
Answers: 2
question
Biology, 22.06.2019 03:20
Mrna decodes information from the original dna master plan to build proteins in the during the process of ribosomes.
Answers: 3
question
Biology, 22.06.2019 09:00
Which of the following types of stars are dim but can have high surface temperatures? giants main sequence stars supergiants dwarfs
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Arthropod body segments are sometimes distinct, sometimes indistinct and sometimes fused as groups t...
Questions
question
English, 02.12.2020 02:10
question
Mathematics, 02.12.2020 02:10
question
Chemistry, 02.12.2020 02:10
question
Mathematics, 02.12.2020 02:10
Questions on the website: 13722367