subject
Biology, 04.04.2020 16:35 lilquongohard

A mutation that inserts or deletes one or two nucleotides is usually more harmful than a mutation that substitutes one base for another because -

A It changes one amino acid in the sequence of a protein

B it shifts the reading frame for the rest of the code causing many errors

C The codon consists of three nucleotides coding for an amino acid

D the chromosomes fail to separate resulting in trisomy 21

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 05:40
Identify characteristics of energy from the sun. check all that apply. almost all of the energy on earth comes from the sun. energy from the sun is known as mechanical energy. the energy in fossil fuels originally came from the sun. plants convert the energy of sunlight into chemical energy.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:00
This rapid change in species that rarely leaves behind fossil evidence is referred to as
Answers: 3
question
Biology, 22.06.2019 13:00
What is the function of the root cap? a. extra-absorbent cells in the root cap absorb more water and nutrients b. protect the meristematic area of the stem c. contains sensors for sunlight d. increases surface area of the root
Answers: 1
You know the right answer?
A mutation that inserts or deletes one or two nucleotides is usually more harmful than a mutation th...
Questions
question
Mathematics, 17.03.2020 00:55
Questions on the website: 13722366