Biology, 04.04.2020 02:29 austinparness02
Although photosynthesis does produce some ATP, these molecules are not used to do the work of the plant cells. What other process occurs in the cells that provides the ATP necessary to do cellular work such as make proteins, divide cells, and move substances across membranes?
Answers: 1
Biology, 21.06.2019 21:30
Now it's your turn to investigate human impact around the world. grab your virtual lab coat and put on your environmental science hat. you will be taking a trip around the globe to explore three locations. at each location, you will investigate the cause and effect relationships of deforestation, desertification, and urbanization. you will also gather evidence of how these factors have impacted the environment over time
Answers: 1
Biology, 22.06.2019 02:30
Plz ! a frog has a genetic mutation in skin cells that causes part of its skin to turn orange the frog will not pass this genetic mutation onto its offspring because, a. the offspring will inherit skin cells from the other parent. b. mutated skin cells cannot divide and produce daughter skin cells. c. skin cells do not contribute genetic material to sex cells. d. parents do not contribute genetic material to their offspring.
Answers: 2
Biology, 22.06.2019 09:00
What causes eclipses? check all that apply. earth's rotation on its axis moon's shadow covering the sun earth's shadow covering the moon earth's orbit and moon's orbit occasionally aligning the moon and sun's gravity pulling in the same direction
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Although photosynthesis does produce some ATP, these molecules are not used to do the work of the pl...
English, 05.06.2021 14:50
Social Studies, 05.06.2021 14:50
Mathematics, 05.06.2021 14:50
Computers and Technology, 05.06.2021 14:50
Biology, 05.06.2021 14:50
History, 05.06.2021 14:50
Mathematics, 05.06.2021 15:00
Social Studies, 05.06.2021 15:00
Computers and Technology, 05.06.2021 15:00
English, 05.06.2021 15:00
Social Studies, 05.06.2021 15:00