subject
Biology, 31.03.2020 22:39 leo4687

Send me a private message please-

When you reach this point, you will have completed the following tasks:
defined cloning, genetic engineering, and artificial selection
identified some advantages and disadvantages of each
practiced determining examples of these procedures
Take a moment to think about the three processes described in this lesson. How do you feel about them?

Should we clone animals?

Is genetic engineering a good idea?

Should people choose mates for animals for specific reasons?

Each of these processes has advantages and disadvantages. For this assessment, you will make a decision as to whether you support or do not support each process. You may support one, or two, or all. Maybe you don’t support any of these processes. Make a decision on each process individually.

Please write a letter to a friend. In this letter, you will describe each process and tell the friend why you either support the use of the process or believe that the process should not be used. Your letter might start off something like this:


Send me a private message please-  When you reach this point, you will have completed the following

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 10:50
Which of the following was not a major animal on land during the carboniferous period? amphibians insects both a and b none of the above
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:50
Involving transcription and translaton. explain the causes and effects of damage to the genetic code.
Answers: 1
question
Biology, 22.06.2019 17:10
How would you describe an allele that be expressed and determines an organisms appearance? a.uncapitalized b.responsive c.recessive d.dominant
Answers: 1
You know the right answer?
Send me a private message please-

When you reach this point, you will have completed th...
Questions
question
Mathematics, 20.07.2019 06:30
question
History, 20.07.2019 06:30
Questions on the website: 13722363