Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?

a. Normal gene: ATGGCCGGCCCGAAAGAGACC
b. Mutated gene: ATGGCCGGCACCGAAAGAGACC
c. Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
d. Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

Which skill, if it cannot be performed by a 3-year-old child, should alert the nurse that the child may be developmentally delayed?

Which would be an adaptation in a rainforest, but not in a tundra? a. ability to store water for a long time b. fur that blends in with snow c. strong claws for killing prey d. a beak that can dig into thick trees

1. environmental factors, such as ph and temperature, can affect the function of an enzyme. a. true b. false 2. which of the following is an organic molecules (ex. vitamins) that an enzyme? a. coenzyme b. product c. active site d. substrate 3. how do enzymes effect the speed of a chemical reaction? a. they speed it up b. they slow it down c. they have no effect on the speed of a reaction 4. during a chemical reaction, an enzyme is used up so that it can only be used one time. a. true b. false 5. which of the following results from a chemical reaction that is catalyzed by an enzymes? a. active site b. product c. substrate d. coenzyme