![subject](/tpl/images/cats/biologiya.png)
Solph is a measure of the acid content of the sol The graph shows the tolerance of earthworms to solph.
Tolerance
Lower limit Zone of Zone of Upper limit
of tolerance stress
stress of tolerance
Optimum range 1
Population
Low
Range of
Soil pH
→ High
In a meadow where earthworms live in the sol the pH gradually decreases from the optimum range into the zone of stress. What is the
MOST LIKELY effect on the earthworm population?
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 23:00
Biomass can be used to generate electricity. biomass relies heavily on agricultural crops. plants release carbon dioxide and water in combustion. plants use photosynthesis to originally generate the energy that is needed. the chemical energy of these plants all started with what energy source?
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 01:30
Which of the following shows the correct order in which light information travels through the eye? (2 points) lens, pupil, retina, optic nerve pupil, lens, retina, optic nerve pupil, lens, optic nerve, retina lens, pupil, optic nerve, retina
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:10
In sweet pea, gene c is responsible for color production and gene p is responsible for the purple color pigment. both of them are located on two different loci on different chromosomes. the flowers will be purple only when the plant has the genotypes as c_p_. no color will be produced with genotypes: ccpp, ccpp, ccpp, ccpp. thus, gene c controls the expression of gene p. what pattern of inheritance is exhibited here? a. pleiotropy b. epistasis c. multiple alleles
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Solph is a measure of the acid content of the sol The graph shows the tolerance of earthworms to sol...
Questions
![question](/tpl/images/cats/istoriya.png)
History, 30.03.2021 19:40
![question](/tpl/images/cats/himiya.png)
Chemistry, 30.03.2021 19:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 19:40
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 19:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 30.03.2021 19:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 19:40
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 19:40
![question](/tpl/images/cats/geografiya.png)
Geography, 30.03.2021 19:40
![question](/tpl/images/cats/biologiya.png)
Biology, 30.03.2021 19:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/es.png)
Spanish, 30.03.2021 19:40
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 19:40
![question](/tpl/images/cats/ekonomika.png)