Biology, 17.03.2020 01:18 kraigstlistt
Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that will then code for a protein, mutations in the DNA can affect the final product. Depending on the severity of the mutation, the protein can range from not being affected to being rendered completely nonfunctional, especially if the reading frame is altered. Which of the following represents a change in reading frame if the template strand of DNA reads as follows?
A) AGCTGGACTTTAGACAAG
B) AGCTGGACTTTAGACAAG
C) AGCTGGACTTGAGTGAACAAG
D) AGCTGGACTATAGACAAG
E) AGCUGGACUUUAGACAAG
F) AGCTGCGACTTTAGACAAG
Answers: 1
Biology, 22.06.2019 01:10
Osmosis is often viewed incorrectly as a process driven directly by differences in solute concentration across a selectively permeable membrane. what really drives osmosis? view available hint(s)osmosis is often viewed incorrectly as a process driven directly by differences in solute concentration across a selectively permeable membrane. what really drives osmosis? the first law of thermodynamicsthe difference in the height of water columns on either side of a selectively permeable membranethe difference in water concentration across a selectively permeable membranethe difference in sugar or ion concentration across a selectively permeable membrane
Answers: 2
Biology, 22.06.2019 08:30
Describe how a non-resistant staphylococcus aureus bacterium can produce a bacterium that is resistant to methicillin
Answers: 1
Biology, 22.06.2019 10:00
With regard to enzymes, key is to lock as a) substrate is to activation energy eliminate b) product is to substrate. c) enzyme is to active site. d) substrate is to active site.
Answers: 1
Biology, 22.06.2019 13:00
Which of the following is an abiotic factor in an ecosystem? a. bacteriab. airc. niched. grass(abiotic=non-living) me !
Answers: 2
Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that w...
Chemistry, 09.07.2020 02:01
History, 09.07.2020 02:01
Computers and Technology, 09.07.2020 02:01
Computers and Technology, 09.07.2020 02:01