subject
Biology, 12.03.2020 05:35 lalllda

True or false. The y-axis of a species-area curve indicates the number of species that can be maintained in a specified area of habitat; currently, precise estimates are only available for vertebrates and plants in tropical rain forests.

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 16:30
Most of earth’s fresh water is found in oceans and seas stored in glaciers and ice caps groundwater stored beneath the surface found in lakes, rivers, streams, and reservoirs
Answers: 1
question
Biology, 22.06.2019 08:00
Vaccines are weakened forms of disease causing microorganisms, which are given to patients to prevent disease. after the vaccine is administered, the immune system responds by creating a(n) to recognize the a.) antibody, antibiotic b.) antigen, antibody c.)antibiotic, antibody d.)antibody, antigen
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
Is becoming less expensive to screen blood samples for dna certain diseases have genetic basis what is possible ethical concern about the availability of inexpensive dna testing
Answers: 1
You know the right answer?
True or false. The y-axis of a species-area curve indicates the number of species that can be mainta...
Questions
question
Biology, 28.05.2020 22:57
question
English, 28.05.2020 22:57
question
Mathematics, 28.05.2020 22:57
question
Mathematics, 28.05.2020 22:57
question
Mathematics, 28.05.2020 22:57
Questions on the website: 13722363