Due to the genetic similarities of non-pathogenic and pathogenic enterics, phenotypic assays are often performed in favor over taxonomy-based sequencing/probing to distinguish pathogens from non-pathogens. Due to the genetic similarities of non-pathogenic and pathogenic enterics, phenotypic assays are often performed in favor over taxonomy-based sequencing/probing to distinguish pathogens from non-pathogens. True False

Approximately what portion of the foods that we eat have been genetically modified in some way? a.fewer than 10% b.about 50% c.nearly 100%

What does polymerase chain reaction (pcr) do? o a. separates dna fragments by size o b. cuts a dna sample into fragments o c. provides an overall picture of a person's chromosomes o d. makes more copies of a sample of dna

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?