subject
Biology, 15.02.2020 05:53 rehel5106

Only 10% of American adults can name the capital of the Czech Republic. On a television game show the three randomly selected contestants are given the question "What is the capital of the Czech Republic?" The probability that none of them will know the answer is about: (a)73% (b) 70% (c) 27% (d) 30% (e) 52% 5. A basketball player makes 70% of his free throws. If he is awarded 20 free throws, then the probability that he will make between 12 and 16 of them (including 12 and 16) is about (a).14 (b) 78 (c) 70 (d).53(e).22

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 02:30
In the diagram below, the northern hemisphere would be in what season at position a a.fall b. winter c.summer d.spring
Answers: 1
question
Biology, 22.06.2019 03:50
Why was mendel's work not accepted at the time? o a. his results were false. o b. he did not repeat his experiments. o c. he did not have any data. o d. his results were surprising,
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:00
Astudy by solloch and et. al., in 2017, gives the map above which shows the frequency of alleles with a ccr5-delta32 mutations over 87 different countries. this mutation deletes the presence of a co-receptor (ccr5) on the outside of human t-cells (lymphocytes). some viruses, such as the one responsible for the black death and human immunodeficiency virus (hiv), require this receptor for attachment to host cells during the infection process. the black death was an epidemic that passed over northern europe during the 14th century killing nearly 60% of europeans. according to this information, which explanation best explains why northern europeans show a greater immunity for hiv than some other parts of the world?
Answers: 1
You know the right answer?
Only 10% of American adults can name the capital of the Czech Republic. On a television game show th...
Questions
question
Mathematics, 17.10.2021 03:50
question
Mathematics, 17.10.2021 03:50
Questions on the website: 13722367