Wyatt and Darnell are designing an experiment to study water mold reproduction. Water mold is an example of a protist that reproduces both sexually and asexually in a process called alternation of generations. The diagram shows that the life cycle of the water mold involves both sexual and asexual reproduction. Look at the diagram of the water mold life cycle. At which point is genetic information combined? A. during the production of flagellated spores B. during fertilization, when two haploid gametes fuse C. during germination and mitosis, where two daughter nuclei are formed D. during meiosis, when male and female gametes are formed

Connection compare and contrast genetic engineering to the process of natural selection. select all statements that are true.

Hershey and chase confirmed that dna, not protein, was the genetic material. how do the results of their two experiments support this conclusion?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?