Biology, 10.02.2020 02:05 ykpwincess
PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Be sure to answer this question in paragraph form using complete sentences.
Answers: 1
Biology, 22.06.2019 15:10
Which of the following requires the use of energy and the of transport proteins to move a molecule across a cell membrane?
Answers: 1
Biology, 22.06.2019 16:30
You will create a molecular clock model for an arthropod gene. follow these guidelines to make your model: . your timeline will span from 90 million years ago to the present. the common ancestor in your model is an arthropod that lived 90 million years ago. the gene that you'll track codes for a protein in the species venom . the dna sequence youll track contains 10 nitrogen bases. you can choose the order of the bases and where the mutations occur. this gene mutates at a rate of approximately 0.76 base pairs every 17.1 million years. to build your model,/ calculate the estimated time period it takes for 1 base pair to mutate. the first time period will only show the common ancestor. at the beginning of the second time period, three lineages will diverge from the common ancestor, each with a different mutation in their gene sequences. the first and third descendant species will survive for the rest of the timeline. the second descendant species was extinct 50 million years ago. calculate how long it will take for one full base pair mutation to occur. explain your reasoning by constructing a mathematical equation
Answers: 2
PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation i...
A certain segment of DNA can be used as a molecular clock. Its rate of mutation i...
Computers and Technology, 01.02.2020 07:43
Computers and Technology, 01.02.2020 07:43
English, 01.02.2020 07:43
Mathematics, 01.02.2020 07:43
Mathematics, 01.02.2020 07:43
Mathematics, 01.02.2020 07:43
Mathematics, 01.02.2020 07:43
Mathematics, 01.02.2020 07:43
Mathematics, 01.02.2020 07:43
Mathematics, 01.02.2020 07:43