Biology, 24.01.2020 23:31 deehunchoo
Some archaea are polyploid. which of the following statements are true regarding archaeal polyploidy? check all that apply
a. archaea must undergo meiosis prior to cell division.
b. each chromosome in a polyploid organism has an identical copy of the organism's genetic information
c. each chromosome in a polyploid organism has distinct genetic information.
d. a mutation that occurs in one chromosome may be phenotypically "rescued by wild type alleles on other chromosomes.
Answers: 1
Biology, 22.06.2019 08:30
What do isotopes of uranium have the same number of? what do they have a different number of? a) same number of protons; different number of electrons b) same number of protons; different number of neutrons c) same number of electrons; different number of protons d) same number of neutrons; different number of protons
Answers: 1
Biology, 22.06.2019 11:30
Use the distance formula to determine weather each pair of segments have the same length
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:50
What happens to the average kinetic energy of water molecules as water freezes?
Answers: 1
Some archaea are polyploid. which of the following statements are true regarding archaeal polyploidy...
Geography, 19.07.2019 01:30
Social Studies, 19.07.2019 01:30
Social Studies, 19.07.2019 01:30
Spanish, 19.07.2019 01:30
History, 19.07.2019 01:30
Mathematics, 19.07.2019 01:30
Mathematics, 19.07.2019 01:30
History, 19.07.2019 01:30
History, 19.07.2019 01:30
History, 19.07.2019 01:30