Hep me with this quiz it closes tonight
question 1 (1 point)
(9.23_q1) in a...
Biology, 13.01.2020 00:31 djderokey7171
Hep me with this quiz it closes tonight
question 1 (1 point)
(9.23_q1) in a closed circuit, the electricity can flow from the negative battery terminal to the positive terminal because of a electrical path is provided.
complete
incomplete
beautiful
ugly
question 2 (1 point)
(9.23_q2) in a dc circuit powered by a battery, the electricity flows from the battery terminal
positive to the negative
negative to the positive
right to the left
left to right
question 3 (1 point)
(9.23_q3) in electricity and electronics, dc stands for
district of columbia
detective comics
direct current
alternating current
question 4 (1 point)
(9.23_q4) the flow of electrons (e-) thru a wire is called
resistance
ohms
electricity
question 5 (1 point)
(9.23_q5) there has to be a reason for electrons to move through a wire. this pressure causing the electrons to move is called
amperes (amps)
current
voltage
ohms
question 6 (1 point)
(9.23_q6) the amount of electrons flowing through a wire is measured in and has the symbol i.
amperes (amps)
resistance
voltage
ohms
question 7 (1 point)
(9.23_q7) electronic materials have resistance to the flow of electrons and it is measured in
amperes (amps)
current
voltage
ohms (ω)
question 8 (1 point)
(9.23_q8) a material which allows fewer electrons to travel through it has
high electrical resistance (high ohms, ω)
low electrical resistance (low ohms, ω)
question 9 (1 point)
(9.23_q9) the flow of electrons thru a wire is called electricity. the amount of electrons flowing through the wire is called
amperes (amps)
current
voltage
ohms
question 10 (1 point)
(9.23_q10) an electronic device meant to provide resistance to the flow of electrons is called a .
resistor
led
wire
question 11 (1 point)
(9.23_q11) which provides more resistance?
a 1 mω resistor
a 1 kω resistor
a 1 ω resistor
question 12 (1 point)
(9.23_q12) what happens if we hook up an led into a circuit in the wrong direction?
the led glows twice as bright as normal
the led glows half as bright as normal
the led glows normally, it makes no difference at all.
the led doesn’t glow at all
question 13 (1 point)
(9.23_q13) the correct formula for calculating the resistance needed to protect an electronic component from too much voltage is
component amps / forward voltage
power source voltage / component amps
(power source voltage - component forward voltage) / component amps
question 14 (1 point)
(9.23_q14) the led lead should be connected to the positive side of the battery.
shorter
longer
right
left
question 15 (1 point)
(9.23_q15) when building a protype circuit in the real world, instead of clamping or soldering connections, we would use a
resistor
breadboard
light emitting diode
Answers: 2
Biology, 21.06.2019 17:40
There are six elements that make up most of the human body. which of the following is not one of these six elements?
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:10
Select the correct answer.what is the observable characteristic of a person called? o a. genotypephenotypeoc.alleleo d.gene
Answers: 2
Biology, 22.06.2019 15:00
Tom wants to conduct a scientific study but he needs to finish by the end of the school year. what practical way could tom work around this limitation and be successful in his study?
Answers: 2
Mathematics, 28.04.2021 03:50
Chemistry, 28.04.2021 03:50
Mathematics, 28.04.2021 03:50
English, 28.04.2021 03:50
Mathematics, 28.04.2021 03:50
English, 28.04.2021 03:50
Mathematics, 28.04.2021 03:50
Mathematics, 28.04.2021 03:50
SAT, 28.04.2021 03:50
Mathematics, 28.04.2021 03:50
Business, 28.04.2021 03:50
Mathematics, 28.04.2021 03:50
Mathematics, 28.04.2021 03:50