Biology, 26.11.2019 05:31 carlosbs71
You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-generated trace of the intensity of each color's fluorescence). in this figure, a = green, c = purple, g = black, t = red. the height of the peaks is unimportant. the 5' end of the sequence is at the left of the trace.
what is the sequence of the template dna used for this sequencing reaction?
a.
5' tttgctttgtgagcggataacaa 3'
b.
3' tttgctttgtgagcggataacaa 5'
c.
5' aaacgaaacactcgcctattgtt 3'
d.
5’ ttgttatccgctcacaaagcaaa 3’
e.
3' aaacgaaacactcgcctattgtt 5'
can someone with this? i can never get more than 3/5 right:
match the following terms with their descriptions below.
question selected match
used to detect close or exact complementarity to a probe sequence
c.
high stringency
used in identifying a specific mrna from a mixture
a.
northern blot
used to quantitate the initial template concentration of an unknown relative to a standard template of known concentration
b.
template dna
reliant upon dna mismatch repair
d.
site-directed mutagenesis
refers to the sequence of interest within the sample in a pcr reaction
e.
cycle threshold method (ct)
Answers: 1
Biology, 22.06.2019 07:00
How much time has elapsed from the very beginning of "the memior of the conquistador bernal diaz del castillo" to the end? a. castillo's whole life b. a quarter of an hour c. a few weeks d. a decade
Answers: 1
Biology, 22.06.2019 10:00
What organ is the first to receive nutrients that have been absorbed from the digestive tract?
Answers: 1
Biology, 22.06.2019 10:30
In order to study genetic mutations, scientists must study genetic material. which statement describes the genetic material scientists are most likely studying? a) they study alleles that contain chromosomes, which are rna.b) they study alleles that contain genes, which are chromosomes.c) they study chromosomes that contain genes, which are dna segments.
Answers: 1
You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-g...
History, 18.03.2021 02:10
Mathematics, 18.03.2021 02:10
Mathematics, 18.03.2021 02:10
Mathematics, 18.03.2021 02:10
Mathematics, 18.03.2021 02:10
English, 18.03.2021 02:10
Mathematics, 18.03.2021 02:10
Mathematics, 18.03.2021 02:10
History, 18.03.2021 02:10
History, 18.03.2021 02:10
Mathematics, 18.03.2021 02:10
Mathematics, 18.03.2021 02:10
Mathematics, 18.03.2021 02:10
Mathematics, 18.03.2021 02:10