Elements are placed into the same period on the periodic table of the elements because they
q...
Biology, 20.11.2019 23:31 bbrogle4070
Elements are placed into the same period on the periodic table of the elements because they
question 1 options:
form the same type of chemical bonds.
form the same type of isotopes.
have the same chemical properties.
have the same number of electron energy levels.
Answers: 1
Biology, 21.06.2019 22:00
Protein synthesis actually begins in the nucleus when transcribes a single gene on the dna molecule is copied. the process of copying this gene is called this copy is known as and contains the protein building instructions. this copy is sent out into the cytoplasm to the part of the cell known as the the of the ribosome will join together to form a functional ribosome when they attach to the mrna. as the mrna moves through the ribosome, the message is read by transfer rna brings the correct back to the ribosome. the amino acids are placed in the correct order and are hitched together by
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:00
Homo heidelbergensis was a tall, muscular hunter, who used both tools and weapons. because h. heidelbergensis was not a gatherer/forager, but ate a varied diet including meat and fish, we would expect to see what anatomical changes?
Answers: 1
Biology, 22.06.2019 15:00
First described the system of fingerprint ridges and spirals, which eventually were used for fingerprinting. a.) fare and fidelis’s pathology b.) dr. calvin goddard c.) hans gross d.) marcelo malpighi e.) leeuvenhoek’s microscope
Answers: 1
Biology, 21.04.2021 15:30
History, 21.04.2021 15:30
Mathematics, 21.04.2021 15:30
Chemistry, 21.04.2021 15:30
Mathematics, 21.04.2021 15:30
Mathematics, 21.04.2021 15:30
Social Studies, 21.04.2021 15:30
History, 21.04.2021 15:30
Advanced Placement (AP), 21.04.2021 15:30