Protein synthesis and mutation cer practice
what is the type of mutation that has occurred in this sequence and its
significance?
original dna sequence: ctgcacctgactcctgaggag
mutated dna sequence: ctgcacctgactcctgggag
claim:

Anurse is caring for a 42-year-old client who is scheduled for an amniocentesis during the fifteenth week of gestation because of concerns regarding down syndrome. what other fetal problem does an examination of the amniotic fluid reveal at this time?

Many humans consume both plants and animals. these humans are considered to be which of the following? herbivores carnivores omnivores

The offspring of two different species