subject
Biology, 17.11.2019 01:31 jvargas0207

Which items are used as types of models check all that apply
a diagram
b illustrations
c observation
d reports
e structures

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 04:00
Aperson is outside exercising. body temperature begins to rise, and the person starts to sweat. their body temperature then returns to normal, and the body stops sweating. a positive b negative c allosteric d homeopathic
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:30
What are levels of ecology and how can we remember them
Answers: 1
question
Biology, 22.06.2019 17:00
Mrna: gcuaauguc what amino acids does the mrna above code for? what type of amino acids or function are uag, uga, and uaa coding for? which codon (3 letters) signals translation to start and also codes for the amino acid methionine (met)?
Answers: 1
You know the right answer?
Which items are used as types of models check all that apply
a diagram
b illustrations<...
Questions
Questions on the website: 13722361