In which of the following ways are dna and mrna similar?
a. they are both always kept in the...
In which of the following ways are dna and mrna similar?
a. they are both always kept in the nucleus to keep them safe from damage.
b. they are both double stranded and must be unzipped during replication and transcription.
c. they both contain the entire genetic sequence of the original dna from their parent cell.
d. they both copy genetic code by forming a complementary sequence of nucleotides with an existing strand of dna.
Answers: 1
Biology, 22.06.2019 04:30
Taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? view available hint(s)taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? the enzyme will not work on human dna.nothing should be altered.the ph should be decreased.the temperature should be raised.
Answers: 2
Biology, 22.06.2019 09:30
Astore manager timed janette to see how long it would take her to fold and put away a sweater, a shirt, a pair of pants, and a scarf. it took her 26.1 seconds for the shirt, 24.3 seconds for the sweater, 32.8 seconds for the pants, and 18.2 seconds for the scarf. what was the average time it took janette to fold and put away all four items? during a catered lunch, an average of 4 cups of tea are poured per minute. the lunch will last 2 hours. how many gallons of tea should the caterer bring if there are 16 cups in one gallon?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
English, 30.04.2021 04:20
Mathematics, 30.04.2021 04:20
History, 30.04.2021 04:20
Mathematics, 30.04.2021 04:20
Mathematics, 30.04.2021 04:20
Mathematics, 30.04.2021 04:20
History, 30.04.2021 04:20
English, 30.04.2021 04:20
Chemistry, 30.04.2021 04:20
Mathematics, 30.04.2021 04:20
English, 30.04.2021 04:20
Mathematics, 30.04.2021 04:20
Mathematics, 30.04.2021 04:20
Mathematics, 30.04.2021 04:20
History, 30.04.2021 04:20