Drag the tiles to the correct boxes to complete the pairs.
match the patterns of inheritance w...
Biology, 26.10.2019 17:43 oliviagilpin8p6lk1i
Drag the tiles to the correct boxes to complete the pairs.
match the patterns of inheritance with the examples.
dominant-recessive
multiple allele
polygenic inheritance
incomplete dominance
long-tailed dogs and short-tailed dogs
produce offspring with medium-length tails.
there are two possible colors for a flower.
and one is more common than the other.
the height of an individual is determined
by multiple genes working together.
despite alleles for a b, and o being present,
only ab blood type is expressed.
Answers: 1
Biology, 22.06.2019 02:30
Suppose you have monohybrid pea plants in your garden and find that they produce round seed to wrinkled seeds in the ratio of 3: 1. if the allele are designated (r & r) receptively. what is the probable genotypes of the round seeds which produced f 1 ? rr & rr rr only rr & rr rr only rr only
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 20.10.2020 04:01
Mathematics, 20.10.2020 04:01
Mathematics, 20.10.2020 04:01
Mathematics, 20.10.2020 04:01
Chemistry, 20.10.2020 04:01
English, 20.10.2020 04:01
Mathematics, 20.10.2020 04:01
Mathematics, 20.10.2020 04:01
Mathematics, 20.10.2020 04:01