Dna replication, transcription, & translation (10 points)
1. provide the (a) dna strand and (b) mrna strand that would be produce from the
following dna template: gctaccgactcgactgcactt
a. dna strand:
b. mrna strand:
2. what enzyme(s) is adding nucleotides to the template dna strand during (a) dna replication
and (b) transcription
a. dna replication:
b. transcription:
3. use the mrna strand from question 1 to translate into a series of proteins. use the
codon chart attached and fill out the chart below.

the statement is true

weathering - colorado river carves land in arizona to form the grand canyon. cracks form in a sandstone wall surrounding a house. a marble statue near the science museum is changing color due to rainfall

erosion - after a rainstorm, soil and rock piees litter the roadways. the sand dunes in the sahara desert are changing shape.

here's your answer.

japan is the correct anwser because i already took the test and i passed it

what are the awnser choices? i mean, without choices, it is an incompleat