subject
Biology, 14.10.2019 17:10 goverton101

In a population of gerbils, long hair (h) is completely dominant over short hair (h). if 18% of the population has short hair, calculate the percentage of the population that is expected to be heterozygous (hh).
a) 29%
b) 49%
c) 58%
d) 80%

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 21:20
Which codon is the code for the amino acid histidine (his)?
Answers: 1
question
Biology, 22.06.2019 07:00
An ecologist studied the same species of deer during the summer and the winter. she noticed that during the summer, when there was plenty of food, the deer were energetic and playful. however, during winter when food was scarce, the deer moved more slowly and did not run unless they needed to escape a predator. which scientific fact is best supported by her observations?
Answers: 3
question
Biology, 22.06.2019 09:00
Select all that apply genes are specific nucleotide sequences occur in numbers that are the same as the number of chromosomes are located in a specific place on a chromosome determine the traits of an organism are units of rna
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
In a population of gerbils, long hair (h) is completely dominant over short hair (h). if 18% of the...
Questions
question
Social Studies, 14.12.2020 23:50
question
Mathematics, 14.12.2020 23:50
Questions on the website: 13722367