Biology, 04.10.2019 23:30 niquermonroeee
The diagram below represents a series of rock layers found at a particular location. each different type of shape shown in the layers represents a fossil of a different species.
suppose each symbol is related to a particular species in the following ways:
a red triangle represents a species of marine crustacean.
a green circle represents a species of jawless fish.
a yellow square represents a species of tree moss.
a purple star represents a species of forest-dwelling insect.
the change shown in the diagram at the end of the devonian geologic period could best be explained by
a.
the melting of a glacier and development of freshwater lakes and rivers.
b.
the environment changing from ocean to dry land.
c.
the arrival of a new predator in the ecosystem.
d.
the environment changing from a cold climate to a warm climate.
Answers: 3
Biology, 21.06.2019 21:00
Name one similarity and one difference between the morphology of a brachiopod and a bivalve
Answers: 1
Biology, 22.06.2019 02:00
Which best describes what you will do in the reaching your academic potential course?
Answers: 2
Biology, 22.06.2019 11:00
Use the above pedigree for questions 1,2, and 3 1. what kind of genetic disorder is represented in the pedigree? a. recessive b. dominate refer to the pedigree in question 1. 2. is the mutated gene in this disorder located on a sex chromosome (x or y) or an autosome? a. sex chromosome b. autosome refer to the pedigree in question 1. 3. which generation has individuals that you are certain are heterozygous for the mutated gene? a. generation 1 b. generation 2 c. generation 3
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The diagram below represents a series of rock layers found at a particular location. each different...
Chemistry, 17.03.2021 23:50
Business, 17.03.2021 23:50
Biology, 17.03.2021 23:50
Mathematics, 17.03.2021 23:50
English, 17.03.2021 23:50
Biology, 17.03.2021 23:50
Business, 17.03.2021 23:50
Mathematics, 17.03.2021 23:50
English, 17.03.2021 23:50
Social Studies, 17.03.2021 23:50
Mathematics, 17.03.2021 23:50
English, 17.03.2021 23:50