What happens to matter in an ecosystem

New york city has 2,181 inhabitants per square mile. the state of alaska has 1.03 inhabitants per square mile. ecologists would say alaska has a low exponential growth population density birth rate carrying capacity

Many farmers prefer cattle without horns because it is safer for their herds. the allele for no horns (n) is dominant to the allele for the presence of horns (n). a farmer mates a male with horns to a heterozygous female without horns. what is the chance that the offspring will have horns?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?