subject
Biology, 18.09.2019 01:30 chandranewlon

Defining neuron, the structure of neurons, the function, and how neurons communicate with each other and the outside world. in your description, define neuron, describe the structure of a neurons (including the parts), explain the function, and how they communicate with each other and the outside world.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 00:40
There is a liquid capsule inside a cup full of liquid. the cup full of liquid has salt in it and the liquid capsule has no salt in it. in which direction will the solvent flow? a. the salt does not have to move b. from the capsule to the larger cup c. equally between the capsule and the cup d. from the larger cup to the capsule
Answers: 1
question
Biology, 22.06.2019 06:30
Photosynthesis uses co2 and cellular respiration produces co2. we call the point when the two processes are in balance--when there is no net production of co2--the compensation point. how might you limit one of the processes in order to achieve a compensation point?
Answers: 3
question
Biology, 22.06.2019 08:50
How do you know that the plant cells in these two images have different jobs, or functions? a. because all plant cells serve different functions b. because they are two different colors c. because their dna are different d. because their structures are different
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Defining neuron, the structure of neurons, the function, and how neurons communicate with each other...
Questions
question
Mathematics, 18.11.2020 04:00
question
Mathematics, 18.11.2020 04:00
question
Mathematics, 18.11.2020 04:00
question
Mathematics, 18.11.2020 04:00
Questions on the website: 13722363