Biological scientists use a variety of methods to gather evidence, or data. if a biologist examines how different variables affect plant growth in a controlled setting, what type of investigation did the biologist perform?
a.
observational field study
b.
model-building
c.
collection of specimens
d.
laboratory experiment

Interpret the model. a three-part model with black right-arrows between the parts. left part: a large green apple-shaped component with a w-shaped indentation centered on top. a small blue apple-slice shape sits above the left indentation and an arrow points from the shape to the indentation. a small purple apple-slice shape and arrow sit above the right indentation and an arrow points from the shape to the indentation. middle part: a large green apple-shaped component with a square indentation centered on top. sitting in the left side of the indentation is a blue apple-slice shape with a flat bottom, fused to a purple apple-slice shape with a flat bottom on the right side of the indentation. right part: a large green apple-shaped component with a w-shaped indentation centered on top. an up-arrow is centered above the indentation pointing to a fused blue and purple apple-slice-shaped flat-bottom component sitting above the indentation. assigne "true" or "false" to the end of each statement. the model shows a shape change occurring in the enzyme after the substrate is bound in the active site. t/fthere are two products in this model. t? f there are three substrates in this model. t/f the model shows two different enzymes. t/f

Which best describes how the common cold spreads in the human body? a bacteria burst out of normal cells killing them b viruses replicate inside respiratory cells c bacteria inject dna into normal cells d viruses insert dna into bacteria

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?