Which type of sensory receptor responds to chemicals? multiple choice
a) taste cells rod and...
Biology, 01.08.2019 02:40 cancerbaby209
Which type of sensory receptor responds to chemicals? multiple choice
a) taste cells rod and cone cells in the retina
b) hair cells in the spiral organ of the inner ear hair
c) cells in the semicircular canal of the inner ear
d)hair cells in the vestibule of the inner ear
Answers: 2
Biology, 22.06.2019 09:00
Suppose you could go back in time to interview henri becquerel on the day he discovered radioactivity. from his perspective, write an account of the discovery.
Answers: 2
Biology, 22.06.2019 09:30
The “ecological footprint” left by a citizen of a developed nation is about four times larger than that left by a citizen of a developing nation. why is this the case?
Answers: 1
Biology, 22.06.2019 11:00
Which of these is true of the cytoplasm of an unfertilized egg? a. it is an unevenly distributed mixture of mrna, proteins, organelles, and other substances. b. it does not contain substances that are important in directing development. c. these substances are supplied by the sperm. d. it does not contain substances that are important in directing development. e. development is directed solely by the surrounding cells. f. it is a homogeneous mixture of mrna, proteins, organelles, and other substances. g. it does not contain substances that are important in directing development. h. these substances are produced by the dna of the fertilized zygote.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 27.07.2019 06:00
Business, 27.07.2019 06:00
Mathematics, 27.07.2019 06:00
English, 27.07.2019 06:00
Mathematics, 27.07.2019 06:00
Chemistry, 27.07.2019 06:00
History, 27.07.2019 06:00
History, 27.07.2019 06:00
English, 27.07.2019 06:00
History, 27.07.2019 06:00